ID: 1097767212_1097767217

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1097767212 1097767217
Species Human (GRCh38) Human (GRCh38)
Location 12:63539710-63539732 12:63539728-63539750
Sequence CCAGAAAAGACCAATGTCCTAGC CTAGCTCAAAGCAGTCAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 4, 3: 19, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!