ID: 1097776684_1097776689

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1097776684 1097776689
Species Human (GRCh38) Human (GRCh38)
Location 12:63655456-63655478 12:63655483-63655505
Sequence CCAGGAAGTAGGCACCTGGGATA TAGGAAATACATAATGGGCATGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 15, 4: 135} {0: 4, 1: 0, 2: 3, 3: 18, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!