ID: 1097790156_1097790160

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1097790156 1097790160
Species Human (GRCh38) Human (GRCh38)
Location 12:63806962-63806984 12:63806988-63807010
Sequence CCTCCAATAATCTGGGCTTCCAC ACCTCAGCCATTCTCTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145} {0: 1, 1: 1, 2: 6, 3: 23, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!