ID: 1097812611_1097812616

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1097812611 1097812616
Species Human (GRCh38) Human (GRCh38)
Location 12:64034984-64035006 12:64035016-64035038
Sequence CCTGCTGGCCACTCATGACCTCA AACTCTTTCAGCCCTGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 161} {0: 1, 1: 0, 2: 2, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!