ID: 1097823340_1097823347

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1097823340 1097823347
Species Human (GRCh38) Human (GRCh38)
Location 12:64149645-64149667 12:64149691-64149713
Sequence CCTGCACCCTGTAAGAATCTTAG TGGCTTCTGCCTTGAGTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 21, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!