ID: 1097848628_1097848635

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1097848628 1097848635
Species Human (GRCh38) Human (GRCh38)
Location 12:64390442-64390464 12:64390484-64390506
Sequence CCACGATGCATGGCTCGTAGGCG CGGGCGGCAGATGCCGCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14} {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!