ID: 1097850241_1097850247

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1097850241 1097850247
Species Human (GRCh38) Human (GRCh38)
Location 12:64404373-64404395 12:64404395-64404417
Sequence CCCGCGGGCTGCCGCCCGCACTC CTCCAAGAGACTGCTGGCGCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 142} {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!