ID: 1097854827_1097854835

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1097854827 1097854835
Species Human (GRCh38) Human (GRCh38)
Location 12:64451809-64451831 12:64451832-64451854
Sequence CCCTTGCTCAGCGTCGGTCCGCC CTACTGTCGGCCAGCGCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} {0: 1, 1: 0, 2: 1, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!