ID: 1097854874_1097854880

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1097854874 1097854880
Species Human (GRCh38) Human (GRCh38)
Location 12:64452015-64452037 12:64452050-64452072
Sequence CCGCGGCTGTGGTGACTACCAGA GTGCGCACGCGCACCCGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78} {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
12 12:64452015-64452037 CCGCGGCTGTGGTGACTACCAGA - 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG +