ID: 1097879886_1097879889

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1097879886 1097879889
Species Human (GRCh38) Human (GRCh38)
Location 12:64677120-64677142 12:64677171-64677193
Sequence CCTTCCTCATTCTTCATTTACAC TGTTTACTACAGTAATTAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 26, 4: 440} {0: 1, 1: 0, 2: 4, 3: 13, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!