|
Left Crispr |
Right Crispr |
| Crispr ID |
1097889230 |
1097889239 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:64760288-64760310
|
12:64760329-64760351
|
| Sequence |
CCGTGGGCGCGGTGGCTCACGCT |
GGAGGCGGGTGGATCACCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 50, 3: 148, 4: 309} |
{0: 170, 1: 10756, 2: 46492, 3: 81402, 4: 95133} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|