|
Left Crispr |
Right Crispr |
Crispr ID |
1097889230 |
1097889240 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:64760288-64760310
|
12:64760334-64760356
|
Sequence |
CCGTGGGCGCGGTGGCTCACGCT |
CGGGTGGATCACCTGAGGTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 6, 2: 50, 3: 148, 4: 309} |
{0: 13130, 1: 55640, 2: 86423, 3: 98097, 4: 93725} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|