ID: 1097895828_1097895844

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1097895828 1097895844
Species Human (GRCh38) Human (GRCh38)
Location 12:64824464-64824486 12:64824507-64824529
Sequence CCCGAACGCAGTTACGCGCCCAC TTCTGGGCACGGGGGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20} {0: 1, 1: 0, 2: 1, 3: 28, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!