ID: 1097899388_1097899396

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1097899388 1097899396
Species Human (GRCh38) Human (GRCh38)
Location 12:64857899-64857921 12:64857947-64857969
Sequence CCTCTAGTCACTGCACTCTCCCA CATGTCTTATGGCCACTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 42, 4: 286} {0: 1, 1: 0, 2: 1, 3: 19, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!