ID: 1097931241_1097931247

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1097931241 1097931247
Species Human (GRCh38) Human (GRCh38)
Location 12:65189321-65189343 12:65189369-65189391
Sequence CCAAGTAAAATAAAAAGGTTGAT CTCTGTGTCCGGAGGGCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 441} {0: 1, 1: 0, 2: 3, 3: 19, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!