ID: 1097951148_1097951155

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1097951148 1097951155
Species Human (GRCh38) Human (GRCh38)
Location 12:65429426-65429448 12:65429464-65429486
Sequence CCAGTGTGGTTGAAGCACAAGGG ATGTGTTTGGAGAGGTAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188} {0: 1, 1: 2, 2: 14, 3: 60, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!