ID: 1097957322_1097957330

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1097957322 1097957330
Species Human (GRCh38) Human (GRCh38)
Location 12:65499492-65499514 12:65499518-65499540
Sequence CCATCAGTGGTTGTATTTATCAC AGGGGAAAGGATCCCAGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 53, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!