ID: 1098024898_1098024902

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1098024898 1098024902
Species Human (GRCh38) Human (GRCh38)
Location 12:66191057-66191079 12:66191085-66191107
Sequence CCAGCACCATTGCTTGTGTTTGG ACTCAAAAGCAGACAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 260} {0: 1, 1: 0, 2: 6, 3: 46, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!