ID: 1098030272_1098030276

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1098030272 1098030276
Species Human (GRCh38) Human (GRCh38)
Location 12:66246520-66246542 12:66246533-66246555
Sequence CCGTGAGAGTTGTGTGGAGCCAA GTGGAGCCAAGGGCTCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134} {0: 1, 1: 0, 2: 4, 3: 32, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!