ID: 1098033271_1098033274 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1098033271 | 1098033274 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:66276544-66276566 | 12:66276563-66276585 |
| Sequence | CCTCTTCTTCCTTGTTTTCCAAT | CAATTCTTTCAGACTTTCCTTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 5, 3: 114, 4: 1102} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||