ID: 1098039561_1098039564

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1098039561 1098039564
Species Human (GRCh38) Human (GRCh38)
Location 12:66340505-66340527 12:66340524-66340546
Sequence CCAGAGGGATGGAACCAATAGGA AGGATATATGTGGATATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 50, 3: 359, 4: 974} {0: 1, 1: 3, 2: 51, 3: 472, 4: 1172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!