ID: 1098047042_1098047044

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1098047042 1098047044
Species Human (GRCh38) Human (GRCh38)
Location 12:66410809-66410831 12:66410846-66410868
Sequence CCCAAACATAGAGAAAGATATCA GAACCTTATAGACCACCTGCAGG
Strand - +
Off-target summary {0: 10, 1: 275, 2: 449, 3: 416, 4: 720} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!