ID: 1098061819_1098061821

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1098061819 1098061821
Species Human (GRCh38) Human (GRCh38)
Location 12:66571025-66571047 12:66571046-66571068
Sequence CCACATCCAGTCTTCTTTCTGCA CACTATCACTTTAGTTAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 448} {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!