ID: 1098141410_1098141418

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1098141410 1098141418
Species Human (GRCh38) Human (GRCh38)
Location 12:67453631-67453653 12:67453673-67453695
Sequence CCCCTAATCAAATCTTTTCTGCT CTGGCGCGGCAGAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 296} {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!