ID: 1098190192_1098190197

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1098190192 1098190197
Species Human (GRCh38) Human (GRCh38)
Location 12:67939703-67939725 12:67939754-67939776
Sequence CCTATCACTAAGTTAATGGTCAG CACAGTCTGAGGCATTACCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!