ID: 1098218416_1098218421

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1098218416 1098218421
Species Human (GRCh38) Human (GRCh38)
Location 12:68243581-68243603 12:68243603-68243625
Sequence CCCAAGGAGGGACTTTGTAACCA AGGCATAGGCGTGATCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 149} {0: 1, 1: 0, 2: 0, 3: 4, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!