ID: 1098231797_1098231806

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1098231797 1098231806
Species Human (GRCh38) Human (GRCh38)
Location 12:68378681-68378703 12:68378726-68378748
Sequence CCCTACTCCCACCATTCCCACAG ATTTCCCTCAGGTGCTAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 380} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!