ID: 1098268322_1098268331

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1098268322 1098268331
Species Human (GRCh38) Human (GRCh38)
Location 12:68746092-68746114 12:68746133-68746155
Sequence CCAGCGGCTCGGGGGCGGAAGCA TGGCTGCGGGCGGAGATGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 284} {0: 1, 1: 0, 2: 2, 3: 11, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!