ID: 1098268832_1098268841

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1098268832 1098268841
Species Human (GRCh38) Human (GRCh38)
Location 12:68750615-68750637 12:68750653-68750675
Sequence CCTGAGAGCCCCTGCTGTTCCAG AGACACGCGGCTGCCTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 276} {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!