ID: 1098394657_1098394661

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1098394657 1098394661
Species Human (GRCh38) Human (GRCh38)
Location 12:70005371-70005393 12:70005397-70005419
Sequence CCTAGTGTGGCAGGTGCAAAGCC GTGATTAATTCTGACCACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!