ID: 1098457163_1098457169

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1098457163 1098457169
Species Human (GRCh38) Human (GRCh38)
Location 12:70687626-70687648 12:70687661-70687683
Sequence CCAAAACACTTTGCAAAAGATCC TTGGGTGACCTAAAGGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 241} {0: 1, 1: 0, 2: 2, 3: 14, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!