ID: 1098493098_1098493102

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1098493098 1098493102
Species Human (GRCh38) Human (GRCh38)
Location 12:71105085-71105107 12:71105105-71105127
Sequence CCCTCTTGGAATACTTGCTTCTC CTCGGTAGGATTTTGTAATTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 286} {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!