|
Left Crispr |
Right Crispr |
| Crispr ID |
1098515964 |
1098515969 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:71376888-71376910
|
12:71376906-71376928
|
| Sequence |
CCGGCGCTTGCGGGCCAGCTGGA |
CTGGAGTTCCGGGTGTGCGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 7, 2: 9, 3: 26, 4: 121} |
{0: 3, 1: 437, 2: 380, 3: 422, 4: 453} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|