ID: 1098515964_1098515974

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1098515964 1098515974
Species Human (GRCh38) Human (GRCh38)
Location 12:71376888-71376910 12:71376932-71376954
Sequence CCGGCGCTTGCGGGCCAGCTGGA GGCGGACACCGCACTCGGAGCGG
Strand - +
Off-target summary {0: 13, 1: 7, 2: 9, 3: 26, 4: 121} {0: 1, 1: 12, 2: 69, 3: 152, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!