ID: 1098520434_1098520439

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1098520434 1098520439
Species Human (GRCh38) Human (GRCh38)
Location 12:71430023-71430045 12:71430067-71430089
Sequence CCCATAAGCTTCAGGTTTGCTTG GAGAAGACCCTCTCATCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 129} {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!