ID: 1098581324_1098581326

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1098581324 1098581326
Species Human (GRCh38) Human (GRCh38)
Location 12:72102708-72102730 12:72102728-72102750
Sequence CCTATAACTGTTAAAATATGCCC CCCCTGTGAAGATGAACATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154} {0: 1, 1: 0, 2: 1, 3: 21, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!