ID: 1098593987_1098593996

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1098593987 1098593996
Species Human (GRCh38) Human (GRCh38)
Location 12:72249435-72249457 12:72249476-72249498
Sequence CCAGTTACTCTGGAGACTGAAGC CTGGAGTTTCAGATCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 46, 2: 1644, 3: 29235, 4: 232467} {0: 2, 1: 66, 2: 2843, 3: 30443, 4: 68094}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!