ID: 1098595823_1098595826

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1098595823 1098595826
Species Human (GRCh38) Human (GRCh38)
Location 12:72272567-72272589 12:72272581-72272603
Sequence CCTGCTCTGGCTGTGGCCCGGGT GGCCCGGGTGGCCCGCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 321} {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!