ID: 1098606080_1098606084

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1098606080 1098606084
Species Human (GRCh38) Human (GRCh38)
Location 12:72391799-72391821 12:72391835-72391857
Sequence CCAACATTCCATGTCTGTAGCAG ATTTCTTATACCTATTGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 14, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!