ID: 1098652585_1098652590

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1098652585 1098652590
Species Human (GRCh38) Human (GRCh38)
Location 12:72991664-72991686 12:72991699-72991721
Sequence CCCAAATCCTTTTGGTGAGACAG CTGGAGTCTATGAAGAGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!