ID: 1098712800_1098712805

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1098712800 1098712805
Species Human (GRCh38) Human (GRCh38)
Location 12:73786994-73787016 12:73787020-73787042
Sequence CCTAATTTCAATATTGTTGTGCT GGACTACAGAAGCTGAGAAGGGG
Strand - +
Off-target summary {0: 2, 1: 37, 2: 291, 3: 671, 4: 937} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!