ID: 1098716123_1098716130

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1098716123 1098716130
Species Human (GRCh38) Human (GRCh38)
Location 12:73830082-73830104 12:73830108-73830130
Sequence CCTTCTCTCCCTCAGTCTGCACT GGCCTCGCGGGGAGTTCCCTAGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 70, 3: 215, 4: 891} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!