ID: 1098722167_1098722172

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1098722167 1098722172
Species Human (GRCh38) Human (GRCh38)
Location 12:73913988-73914010 12:73914031-73914053
Sequence CCTAAGGAAGTCAAAGGAAAAGA CAGGGTGACTAGATGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 706} {0: 1, 1: 0, 2: 2, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!