ID: 1098731049_1098731053

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1098731049 1098731053
Species Human (GRCh38) Human (GRCh38)
Location 12:74037321-74037343 12:74037360-74037382
Sequence CCTGCTATCTTCTGCAGATAACT ACAGCTGTTGGCCTGTTACTGGG
Strand - +
Off-target summary No data {0: 6, 1: 191, 2: 200, 3: 162, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!