ID: 1098731049_1098731054

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1098731049 1098731054
Species Human (GRCh38) Human (GRCh38)
Location 12:74037321-74037343 12:74037366-74037388
Sequence CCTGCTATCTTCTGCAGATAACT GTTGGCCTGTTACTGGGCTTTGG
Strand - +
Off-target summary No data {0: 5, 1: 187, 2: 172, 3: 109, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!