ID: 1098748634_1098748643

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1098748634 1098748643
Species Human (GRCh38) Human (GRCh38)
Location 12:74269033-74269055 12:74269065-74269087
Sequence CCCTCCAAGTGCATGGAGCATTA AAGGGCCTGTTAAACTCTGGGGG
Strand - +
Off-target summary {0: 11, 1: 17, 2: 29, 3: 36, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!