ID: 1098753161_1098753169

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1098753161 1098753169
Species Human (GRCh38) Human (GRCh38)
Location 12:74321819-74321841 12:74321860-74321882
Sequence CCCTACTGGAAGGTAGGCATGTG TTATAGGCTCAGAACTGGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 5, 3: 49, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!