ID: 1098770384_1098770387

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1098770384 1098770387
Species Human (GRCh38) Human (GRCh38)
Location 12:74545018-74545040 12:74545050-74545072
Sequence CCCTACTCAGTATGATTAAATTT GTGATGACATCAACTCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 263} {0: 1, 1: 0, 2: 2, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!