|
Left Crispr |
Right Crispr |
| Crispr ID |
1098830935 |
1098830941 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:75361537-75361559
|
12:75361584-75361606
|
| Sequence |
CCCAAGCTGTACCTCAGCCTGTT |
GACTCATGGTTCCACGTGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 9, 3: 63, 4: 635} |
{0: 1, 1: 11, 2: 159, 3: 1409, 4: 6055} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|