ID: 1098831904_1098831906

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1098831904 1098831906
Species Human (GRCh38) Human (GRCh38)
Location 12:75374014-75374036 12:75374041-75374063
Sequence CCACTTACAGGCCAAGAGCTTTC AAAATGAAAGTAGTTATCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 202, 4: 339} {0: 1, 1: 2, 2: 9, 3: 64, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!